Ksante ugg

Its a very powerful tool in K’sante’s kit for engage/insec/ or heck even just for damage. But MAN does it feel like a BRUTAL punishment for pressing that button. Sure you can gain …The Pride of Nazumah, K'Sante, was initially alluded to in the April 2022 Champion Roadmap, when the game's creators called him a "high skill" top lane tank. He will join Shurima's existing champion lineup, which consists of Azir, Xerath, Nasus, Renekton, Sivir, Skarner, Amumu, and Rammus, as the 162nd champion in League of Legends. best pizza delivery near me The highest win rate K'Sante runes, items, skill order and summoner spells in patch 13.1. Builds ARAM Counters Guide Combos Pro Builds Platinum + Ranked Solo 13.1 All …UGG® Official | Boots, Slippers & Shoes | Free Shipping & Returns For the ones you love most For family, friends, partners, or even yourself – show how much you care. Shop Our … verizon disney bundle activation K'Sante The Pride of Nazumah Find the best K'Sante build guides for League of Legends S13 Patch 13.3. The MOBAFire community works hard to keep their LoL builds and … yard machines 550ex K'Sante The Pride of Nazumah Find the best K'Sante build guides for League of Legends S13 Patch 13.3. The MOBAFire community works hard to keep their LoL builds and guides updated, and will help you craft the best K'Sante build for the S13 meta. Learn more about K'Sante's abilities, skins, or even ask your own questions to the community!Oct 14, 2022 · K'Sante wields an intriguing weapon according to his lore. It was made from the hide of the Ntofos, the fiercest beasts in the Shuriman desert. It is a large blunt object the size of a bat or hammer. K’Sante: The Pride of Nazumah | Gameplay Trailer - League of Legends Watch on After months of anticipation, Riot Games has unveiled the upcoming tank top laner, K’Sante. In League of Legends, there are many sub-classes; none are as … office park near meOct 19, 2022 · K’Sante will be released in League of Legends patch 12.21, which will likely be in November. Read more about the new champion’s background, his ability rundown, and how Naruto actually inspired his ultimate. Follow ONE Esports on Facebook and Twitter for more LoL news, guides, and highlights. Cho K'sante thêm giáp và sát thương. Hình dung không bạn sẽ vừa có giáp từ kỹ năng và giáp từ ngọc cộng thêm, gấp đôi canxi để làm gì. Các ngọc còn lại là "Ngọn gió thứ hai" …K'Sante top has a 45.64 % win rate in Platinum + on Patch 13.3 coming in at rank 48 of 91 and graded B Tier on the LoL Tierlist. K'Sante top is a strong counter to Sion, Yone & Shen while K'Sante is countered most by Rumble, Darius & Olaf. The best K'Sante players have a 59.02 % win rate with an average rank of Master on the K'Sante Leaderboard. 24 hour daycares near me Footwork. K'Sante se lanza hacia adelante, ganando un escudo temporalmente. Si se lanza hacia un aliado, la distancia es mucho mayor, y además los escuda. Se pueden utilizar otras habilidades durante Footwork. Si se usa con All Out, la velocidad de movimiento de esta habilidad se incrementa. Se aumenta su rango y además se puede atravesar ...26K views 2 months ago The New Champion K'sante is finally here and with our New Season 13 Patch 12.22 IMMORTAL Build he is going to be literal unstoppable, 500+ Shields with E and another 450+... Screenshot by Amanda Tan/ONE Esports. The first black LGBTQ champion in the League of Legends universe, as confirmed by his voice actor DeObia Oparei, K’Sante, Pride of …Aug 12, 2022 · Instead, K’sante is their champion. He got his title and name by fighting off a mighty beast while leading Nazumah’s warriors. He created a unique weapon called a Ntofos which helps him to regenerate. It is described as a “huge, blunt weapon” that can be used defensively. Then K’Sante can shatter it into blades and go on the attack. K'Sante · Runes for Top Power Spike P Q W E R Get everything you need for K'Sante Top build! The highest win rate K'Sante runes, items, skill order and summoner spells in patch 13.3. Builds ARAM Counters Guide Combos Pro Builds Platinum + Ranked Solo 13.3 All regions Builds Runes Expert Video Guide K'Sante Runes Top ∙ Patch 13.3The highest win rate K'Sante runes, items, skill order and summoner spells in patch 13.1. Builds ARAM Counters Guide Combos Pro Builds Platinum + Ranked Solo 13.1 All regions Builds Runes Expert Video Guide K'Sante Build Top ∙ Patch 13.1 Most Popular Win Rate 54.9% based on 53 478 matches Import this build directly into your game client:U.GG LoL K'Sante build shows best K'Sante runes by WR and popularity. With matchups, skill order and best items, this K'Sante guide offers a full K'Sante Top build for League … romeo's pizza fayetteville photos Defiant and courageous, K’Sante battles colossal beasts and ruthless Ascended to protect his home of Nazumah, a coveted oasis amid the sands of Shurima. But after a falling-out with his former partner, K'Sante realizes that in order to become a warrior worthy of leading his city, he must temper his single-minded drive for success. The highest win rate K'Sante runes, items, skill order and summoner spells in patch 13.1. Builds ARAM Counters Guide Combos Pro Builds Platinum + Ranked Solo 13.1 All …Statistical K'Sante URF build guide with best runes, item build, skill order, counters, summoner spells, trinkets, and mythic items, 13.3. free puppies davenport iowa 26K views 2 months ago The New Champion K'sante is finally here and with our New Season 13 Patch 12.22 IMMORTAL Build he is going to be literal unstoppable, 500+ Shields with E and another 450+... watch prey 2022 123movies Screenshot by Amanda Tan/ONE Esports. The first black LGBTQ champion in the League of Legends universe, as confirmed by his voice actor DeObia Oparei, K’Sante, Pride of …Defiant and courageous, K'Sante battles colossal beasts and ruthless Ascended to protect his home of Nazumah, a coveted oasis amid the sands of Shurima. But after a falling-out …Screenshot by Amanda Tan/ONE Esports. The first black LGBTQ champion in the League of Legends universe, as confirmed by his voice actor DeObia Oparei, K’Sante, Pride of … excessively fast crossword clue Welcome to the METAsrc statistical K'Sante ARAM build guide, 13.1 NA. We have calculated the highest win rate item build, best runes for K'Sante, mythic items, skill order, full item build, starting items, summoner spells, item build order, trinkets, and counters.K'Sante Ultimate Interaction Fixed on PBE Server 12.21 Until a while ago players, when standing in the perfect spot, had the opportunity to yeet the enemy from the alcove, all the way back into the fountain with K'Sante's ultimate, the top lane tank even teleporting to the enemy fountain as well as is the interaction of his ultimate.. Well, this interaction has been cut from the game.The highest win rate K'Sante runes, items, skill order and summoner spells in patch 13.3. 13.3 ทุกภูมิภาค Builds Runes Expert Video Guide K'Sante Build Top ∙ แพทช์ 13.3 Most Popular Win Rate 52.6% based on 3 793 matches Import this build directly into your game client: Import to Client Recommended builds Build WR Most Popular 52.6% Optional 50.1% kentucky land watch K'Sante's Matchups Lane Win Rate Game Win Rate K'Sante wins lane against... Shen 1372 Matches 63.1% in Lane 44.5% in Game Cho'Gath 294 Matches 62.6% in Lane 49.3% in Game Singed 505 Matches 61.4% in Lane 47.3% in Game Quinn 231 Matches 58.4% in Lane 52.8% in Game Malphite 479 Matches 57.8% in Lane 48.4% in Game Dr. Mundo 826 Matches 55.8% in LaneK'Sante top has a 45.64 % win rate in Platinum + on Patch 13.3 coming in at rank 48 of 91 and graded B Tier on the LoL Tierlist. K'Sante top is a strong counter to Sion, Yone & Shen while K'Sante is countered most by Rumble, Darius & Olaf. The best K'Sante players have a 59.02 % win rate with an average rank of Master on the K'Sante Leaderboard. K'Sante · DlPLEX. Cloud9 Diplex · Fiddlesticks. dard. OpTic Gaming ... K'Sante · BurritoTopKing. Challenger · Aurelion Sol. One Iast time. GrandMaster.Tier: B Win45.84% Role92.87% Pick4.74% Ban10.05% Games: 36383 KDA: 1.78 Score: 54.77. Welcome to the METAsrc statistical K'Sante build guide, Top Lane 13.3. We have calculated the highest win rate item build, best runes for K'Sante, mythic items, skill order, full item build, starting items, summoner spells, item build order, trinkets, and ... shotgun spratling Defiant and courageous, K'Sante battles colossal beasts and ruthless Ascended to protect his home of Nazumah, a coveted oasis amid the sands of Shurima. But after a falling-out with his former partner, K'Sante realizes that in order to become a warrior worthy of leading his city, he must temper his single-minded drive for success.K'Sante. 45.9%. Aphelios. 45.6%. Zed. 42.8%. Guest Account. Download Blitz · Settings · Sign Up for Account. Wallet. Coming Soon. Expand. bathroom faucets at lowes Welcome to the METAsrc statistical K'Sante build guide, Top Lane 13.3. We have calculated the highest win rate item build, best runes for K'Sante, mythic items, skill order, full item build, starting items, summoner spells, item build order, trinkets, and counters.Oct 14, 2022 · K'Sante wields an intriguing weapon according to his lore. It was made from the hide of the Ntofos, the fiercest beasts in the Shuriman desert. It is a large blunt object the size of a bat or hammer. K’Sante: The Pride of Nazumah | Gameplay Trailer - League of Legends Watch on UGG Sandales W Fluff Yeah Terry 102,06 € UGG Chaussons OH YEAH 104,00 €-18%. 84,90 € UGG ...Tier: C Win50.89% Pick3.56% Games: 786 KDA: 3.07 Score: 40.75. Welcome to the METAsrc statistical K'Sante ARAM build guide, 13.3. We have calculated the highest win rate item build, best runes for K'Sante, mythic items, skill order, full item build, starting items, summoner spells, item build order, trinkets, and counters. anime eye transparent background Oct 17, 2022 · Published October 16, 2022, 9:54 PM PDT. By XC Enriquez · 3 min read. Follow Us. K’Sante, the Pride of Nazumah, is League of Legends’ 162nd champion. Read on for K’Sante’s abilities ... sam's new year's day hours K'Sante vs Sett Matchup Statistics :: Counter Picking Stats for League of Legends by CounterStats K'Sante vs Sett in the Top Lane Counter Stats Calculated When Both in the Top Lane Only K'Sante VS Sett All Cha Mas Dia Pla Counter Kills 51% 49% Champion Kills 49% 51% Early Lead Ratio 34% 39% Comeback Ratio 15% 12% Win Percent 52% 48%K'Sante is the next champion to arrive in League of Legends This next update will follow the Halloween update with some equally thematic skins, introducing the Empyrean skin line, featuring some of Leagues favourite Champions and the latest addition K'Sante himself. Here’s what’s new in update 12.21 for LoL. Release DateK'Sante top has a 45.64 % win rate in Platinum + on Patch 13.3 coming in at rank 48 of 91 and graded B Tier on the LoL Tierlist. K'Sante top is a strong counter to Sion, Yone & Shen while K'Sante is countered most by Rumble, Darius & Olaf. The best K'Sante players have a 59.02 % win rate with an average rank of Master on the K'Sante Leaderboard. K'Sante · Combos. Get everything you need for K'Sante Top build! The highest win rate K'Sante runes, items, skill order and summoner spells in patch 13.3. Stack up your Q … heartland cyclone 4014c K'Sante is a champion in League of Legends. [1] Base statistics KSante Edit Health 610+108 Mana 290+60 Health regen. (per 5s) 9.5+0.85 Mana regen. (per 5s) 7+1 Armor 33+4.7 Attack damage 64+3.5 Magic resist. 30+2.1 Crit. damage 175% Move. speed 335 Attack range 175 Attack speed Base AS 0.625 Attack windup 19.531% AS ratio N/A Bonus AS +2.5 %Selamlar bugün league of legends yeni şampiyon ksante oynadım. Kayle karşı oynadığım lane baya rahat geçti aslında ama şampiyon bir garip güçlü gibi değil gi... youtube fgteev K'Sante · Combos. Get everything you need for K'Sante Top build! The highest win rate K'Sante runes, items, skill order and summoner spells in patch 13.3. Stack up your Q first, then E, Q Flash onto your enemy to engage. Follow that with an AA and your R. Then, batter your enemy down with AA, W, AA, Q and AA.What skin themes do you think Ksante will get :)? What skin themes are you hoping to get for skins for this champ? 6. 7 comments. share. save. About Community. Welcome to K'Sante Mains! This subreddit is dedicated to League's most courageous monster hunter, the Pride of Nazumah. Here, you can discuss his lore, builds, strategies, and more! what does deter mean on vivint Footwork. K'Sante se lanza hacia adelante, ganando un escudo temporalmente. Si se lanza hacia un aliado, la distancia es mucho mayor, y además los escuda. Se pueden utilizar otras habilidades durante Footwork. Si se usa con All Out, la velocidad de movimiento de esta habilidad se incrementa. Se aumenta su rango y además se puede atravesar ...5’ATGTAAACCACTACATAG3’ Template: 3’UAC AUU UGG UGA UGU AUG5’ mRNA: 5’AUG UAA ACC ACU ACA UAG3’ Start Codon: We have dog breath. 4) 5’ATGAGAAGTAGGAGAAGCATAATCTAG3’ Template: 3’UAC UCU UCA UCC UCU UCG UAU UAG5’ mRNA:5’AUG AGA AGU AGG AGA AUA UAC3’ Start: The Beatles are the …Oct 17, 2022 · Published October 16, 2022, 9:54 PM PDT. By XC Enriquez · 3 min read. Follow Us. K’Sante, the Pride of Nazumah, is League of Legends’ 162nd champion. Read on for K’Sante’s abilities ... Selamlar bugün league of legends yeni şampiyon ksante oynadım. Kayle karşı oynadığım lane baya rahat geçti aslında ama şampiyon bir garip güçlü gibi değil gi... lipstickalley I played 2 games with Ksante in my team where he got fed in lane and couldn't do anything with that lead. If it was Ornn he would literally 1v9 while being much more versatile. I …Aug 30, 2022 · K’Sante will have the ability to alternate between defense and offense. K’Sante is a champion of the masses who are fighting against the monsters in Nazumah. This area called the oasis inhabits people who are struggling against giants who are limiting food and water. K’Sante becomes their savior and hunter, utilizing a unique weapon dubbed Ntofos. Welcome to the METAsrc statistical K'Sante ARAM build guide, 13.1 NA. We have calculated the highest win rate item build, best runes for K'Sante, mythic items, skill order, full item build, starting items, summoner spells, item build order, trinkets, and counters.www.op.ggFind local businesses, view maps and get driving directions in Google Maps. miniature shih tzu price K'Sante smashes an enemy away. If the enemy hits a wall they will go through the wall taking more damage. K'Sante will appear behind the target and goes All Out by shredding his defenses but greatly increasing his damage. Flash Teleports your champion a short distance toward your cursor's location. SmiteU.GG takes the guesswork out of K'Sante runes. LoL Patch 13.3 Build Runes Runes ARURF ARAM Counters Leaderboards Pro Builds More Stats Filters Top Platinum + VS. … 20th century fox 3d warehouse The highest win rate K'Sante runes, items, skill order and summoner spells in patch 13.3. 13.3 ทุกภูมิภาค Builds Runes Expert Video Guide K'Sante Build Top ∙ แพทช์ 13.3 Most Popular Win Rate 52.6% based on 3 793 matches Import this build directly into your game client: Import to Client Recommended builds Build WR Most Popular 52.6% Optional 50.1% Free shipping BOTH ways on ugg boots from our vast selection of styles. Fast delivery, and 24/7/365 real-person service with a smile. Click or call 800-927-7671.Instead, K'sante is their champion. He got his title and name by fighting off a mighty beast while leading Nazumah's warriors. He created a unique weapon called a Ntofos which helps him to regenerate. It is described as a "huge, blunt weapon" that can be used defensively. Then K'Sante can shatter it into blades and go on the attack. x 1 squared On Oct 13, Riot Games uncovered the newest addition to the League of Legends champion pool— K’Sante. The champion will be a high-skill bruiser catered to the top lane. But there’s much more to him...Oct 14, 2022 · K'Sante wields an intriguing weapon according to his lore. It was made from the hide of the Ntofos, the fiercest beasts in the Shuriman desert. It is a large blunt object the size of a bat or hammer. K’Sante: The Pride of Nazumah | Gameplay Trailer - League of Legends Watch on Defiant and courageous, K'Sante battles colossal beasts and ruthless Ascended to protect his home of Nazumah, a coveted oasis amid the sands of Shurima. But after a falling-out … amazon shower enclosuresWELCOME TO UGG® PORTUGAL. Welcome to the home of beautifully soft and comfortable footwear! Here in Portugal, we know you love well made shoes. You'll be pleased to know all UGG® boots, shoes, slippers, trainers and sandals are ergonomically designed to be as comfortable and supportive as possible - without sacrificing your signature style.Slip-on Beige Cotone - 110793298 - Beige Homme 49,90 € - Spartoo. Spartoo utilise des cookies strictement nécessaires au fonctionnement du site internet, ainsi que pour la personnalisation du contenu et l'analyse du trafic.Welcome to the METAsrc statistical K'Sante URF build guide, 13.3. We have calculated the highest win rate item build, best runes for K'Sante, mythic items, skill order, full item build, starting items, summoner spells, item build order, trinkets, and counters. how to use smart vinyl K'Sante. 45.9%. Aphelios. 45.6%. Zed. 42.8%. Guest Account. Download Blitz · Settings · Sign Up for Account. Wallet. Coming Soon. Expand.İlham. Bu, çok iyi uyan bir K'Sante rün setidir. Seçilen rünleri tamamlamak için K'Sante Build ziyaret etmelisiniz. skradski funeral home obituaries K'Sante slams his weapon, dealing physical damage in a small area around him and briefly Slowing targets hit. If an enemy is hit, K'Sante gains a stack for a short duration. At 2 stacks, K'Sante instead fires a shockwave that Pulls enemies All Out: This ability's cooldown is reduced and no longer slows targets hit. W - Path Maker18 de out. de 2022 ... K'Sante is the next champion in League of Legends, here's everything you need to know!Oct 17, 2022 · Published October 16, 2022, 9:54 PM PDT. By XC Enriquez · 3 min read. Follow Us. K’Sante, the Pride of Nazumah, is League of Legends’ 162nd champion. Read on for K’Sante’s abilities ... target sezzle Welcome to the METAsrc statistical K'Sante ARAM build guide, 13.1 NA. We have calculated the highest win rate item build, best runes for K'Sante, mythic items, skill order, full item build, starting items, summoner spells, item build order, trinkets, and counters.K'Sante Pro Players Builds (Recent games) Buggax. The Kings (NA) VS. Defeat. Soloqueue. 4 hours ago. 3 / 3 / 2. 185 CS - 8.8k gold.League of Legends Rankings dos Jogadores, estatísticas, habilidades, builds. Estatísticas dos Campeões, popularidade, índice de vitória, melhores itens e ... comcast.net sign in Ticket prices cost as little as $17.99, with an average price of $20.99. To get the cheapest tickets, book online in advance and avoid busy times like weekends and public holidays. The distance between Budapest and Cluj-Napoca is 300 miles, which takes as little as 9 hours with our fastest rides. Make your journey even easier with the FlixBus app.K'Sante Top 28,908 matches ( Last 2 days ) Home > Runes > K'Sante Overview Stats ProBuilds Matchups Runes Skills Items Summoner Spells Jungle Paths K'Sante VS All … fedex package handler website Its a very powerful tool in K’sante’s kit for engage/insec/ or heck even just for damage. But MAN does it feel like a BRUTAL punishment for pressing that button. Sure you can gain … nba tv fios Welcome to the METAsrc statistical K'Sante build guide, Top Lane 13.3. We have calculated the highest win rate item build, best runes for K'Sante, mythic items, skill order, full item build, starting items, summoner spells, item build order, trinkets, and counters.Betty London habille les femmes d'une robe dont le style et le caractère sauront faire la différence. Sa composition en coton (100%) ainsi que sa couleur noire vous séduiront. Tellement féminine et donc tellement indispensable ! - INNATU - Noir Femme 28,00 € - … old navy pants men's Welcome to the METAsrc statistical K'Sante ARAM build guide, 13.1 NA. We have calculated the highest win rate item build, best runes for K'Sante, mythic items, skill order, full item build, starting items, summoner spells, item build order, trinkets, and counters. horizon 56 palm harbor Aug 12, 2022 · Instead, K’sante is their champion. He got his title and name by fighting off a mighty beast while leading Nazumah’s warriors. He created a unique weapon called a Ntofos which helps him to regenerate. It is described as a “huge, blunt weapon” that can be used defensively. Then K’Sante can shatter it into blades and go on the attack. The highest win rate K'Sante runes, items, skill order and summoner spells in patch 13.3. 13.3 ทุกภูมิภาค Builds Runes Expert Video Guide K'Sante Build Top ∙ แพทช์ 13.3 Most Popular Win Rate 52.6% based on 3 793 matches Import this build directly into your game client: Import to Client Recommended builds Build WR Most Popular 52.6% Optional 50.1% Oct 19, 2022 · K’Sante will be released in League of Legends patch 12.21, which will likely be in November. Read more about the new champion’s background, his ability rundown, and how Naruto actually inspired his ultimate. Follow ONE Esports on Facebook and Twitter for more LoL news, guides, and highlights. Nov 4, 2022 · His name is K’Sante, and he is a tank/skirmish-heavy Top laner. He will most likely be played in the Top lane of League of Legends. He has many different CC tools in his kit, which he can use to make plays and set up kills for his team. His kit is pretty simple, but it is all about landing skill shots and timing early on. Cho K'sante thêm giáp và sát thương. Hình dung không bạn sẽ vừa có giáp từ kỹ năng và giáp từ ngọc cộng thêm, gấp đôi canxi để làm gì. Các ngọc còn lại là "Ngọn gió thứ hai" … malu trevejo.leaked Su nombre es K'Sante, el Orgullo de Nazumah. Ya conocemos distintos detalles, entre ellos su kit de habilidades. La comunidad parece haber quedado encantada con este nuevo campeón, aunque también hemos visto los míticos « ese personaje va a salir completamente roto «.Nov 4, 2022 · His name is K’Sante, and he is a tank/skirmish-heavy Top laner. He will most likely be played in the Top lane of League of Legends. He has many different CC tools in his kit, which he can use to make plays and set up kills for his team. His kit is pretty simple, but it is all about landing skill shots and timing early on. The highest win rate K'Sante runes, items, skill order and summoner spells in patch 13.1. Builds ARAM Counters Guide Combos Pro Builds Platinum + Ranked Solo 13.1 All regions Builds Runes Expert Video Guide K'Sante Build Top ∙ Patch 13.1 Most Popular Win Rate 54.9% based on 53 478 matches Import this build directly into your game client: cookieswirl c roblox Droit de rétractation Vous disposez d'un droit légal de rétractation. En Votre qualité de consommateur au sens des dispositions du Code de la consommation, vous disposez d'un délai de quatorze (14) jours pour exercer Votre droit de rétractation à compter de la date de réception des Produits par Vous-même ou tout destinataire sans avoir à motiver Votre …Aug 30, 2022 · K’Sante will have the ability to alternate between defense and offense. K’Sante is a champion of the masses who are fighting against the monsters in Nazumah. This area called the oasis inhabits people who are struggling against giants who are limiting food and water. K’Sante becomes their savior and hunter, utilizing a unique weapon dubbed Ntofos. K'Sante URF Build LoL Patch 13.3. Tier: D Win29.13% Pick1.57% Ban0.00% Games: 8610 KDA: 1.25 Score: 33.09. Welcome to the METAsrc statistical K'Sante URF build guide, 13.3. We have calculated the highest win rate item build, best runes for K'Sante, mythic items, skill order, full item build, starting items, summoner spells, item build order ... cbssports.com 26K views 2 months ago The New Champion K'sante is finally here and with our New Season 13 Patch 12.22 IMMORTAL Build he is going to be literal unstoppable, 500+ Shields with E and another 450+... walker mcfadden car accident utah Un choix unique de Ugg jaune disponible dans notre magasin. Codes promo, ventes flash, livraison offerte, trouvez le produit de vos rêves à prix réduit !The Pride of Nazumah, K'Sante, was initially alluded to in the April 2022 Champion Roadmap, when the game's creators called him a "high skill" top lane tank. He will join Shurima's existing champion lineup, which consists of Azir, Xerath, Nasus, Renekton, Sivir, Skarner, Amumu, and Rammus, as the 162nd champion in League of Legends.Play and build K'Sante like the best. Top rated K'Sante guides, from matchups to rune and item builds to combos. Updated for LoL Patch 13.3. haircuts in walmart The highest win rate K'Sante runes, items, skill order and summoner spells in patch 13.1. Builds ARAM Counters Guide Combos Pro Builds Platinum + Ranked Solo 13.1 All …K'Sante is bullshit in many ways, but in this specific situation a level 15 Ornn, Malphite, Sejuani, Rammus and Sion can all easily burst 1300 with majority duration hard cc. Bo knows that and that's why he's not throwing a tantrum about K'Sante, but rather about Nunu misplaying. 88 Reply Gluroo • 5 days ago Women's Classic Clear Mini Boot. Original price £145 Now £69.99. Women's Fuzz Sugar Slide. Original price £100 Now £70.99. | 2 Colours. Men's Classic Short Deco Boot. Original price £175 Now £124.99. | 2 Colours. Women's Marlene Sherpa Jacket.Tier: B Win45.84% Role92.87% Pick4.74% Ban10.05% Games: 36383 KDA: 1.78 Score: 54.77. Welcome to the METAsrc statistical K'Sante build guide, Top Lane 13.3. We have calculated the highest win rate item build, best runes for K'Sante, mythic items, skill order, full item build, starting items, summoner spells, item build order, trinkets, and ... where is my atandt account number